About 10,889 results found. (Query 0.09200 seconds)
The incredible speed of memchr
http://glfwtfwhlsm2u5pw3b7crist7bt7fwepj2wgv3n3b64unj22v5435tyd.onion/blog/2022/12/10/The-Incredible-speed-of-memchr.html
These file formats are heavily text-based formats, e.g: fasta, .fastq, .sam, .vcf. A very typical operation we apply is finding a new line in a huge buffer. Think of something like: char* str = "ACGTACGTACGTACGTACGTACGT\nACGTACGTACGTACGTACGT\n" // find the position of the next new line So what is the fastest way of finding these new lines?
Хостинг для игр на LogicServers.co.uk - GoodGameServers.com
http://www.goodgamell762ckqk376pqtg7ltdhgtvsvk32m7im2v5ntd3o33ylbqd.onion/ru/game-hosters/logicservers-co-uk-hosting
ARK: SOTF 7 Days to Die Terraria Unturned Space Engineers Medieval Engineers Rust Conan Exiles Dark and Light Citadel: Forged With Fire Rend NEW! Outpost Zero NEW! Empyrion The Forest NEW! Ylands Battalion 1944 Blackwake ROKH Hurtworld Перейти на LogicServers.co.uk Описание: DDoS Protection All our hosting comes with automated protection from attackers, so that your servers are never effected.
Contact - Darknet-Märkte Linkverzeichnis.
http://u5n3wlq5nk7db3a7wjps3fmw3igl5dtvimy6xgqi7fgevji5jqyqhpqd.onion/de/contact/index.html
Primary Menu Best Darknet Markets List 2024 About Donate What Is Darknet? What Is Tor? Contact Contact Contact us to submit new markets [email protected] James G. Carpenter -----BEGIN PGP PUBLIC KEY BLOCK----- Version: BCPG C#...
Planet Debian
http://3cbzkrvakrpetjjppdwzbzqrlkmzatjs7jbyazap5gwutj32gcltjpqd.onion
If you're not paying close attention to everything that's going on all the time in the Linux world, you miss a lot of the nice new features and tools. It's common for people to only realize there's a cool new trick available only years after it was first introduced.
Home - ASAP Market
http://asap2u25jeqwa7c7bsqmu437pcozg7j6rvcjqvcw7dkoast2hnv5btid.onion/index.php
Login Register Home Market New Updates Published by admin 5/25/2023 10:39:07 PM Delete feedback within 2 days Close ticket Get new deposit address Best regards ASAP Admin Expand Featured listings ID TEMPLATE MEGAPACK - TEMPLATES,CC,PASSPORTS,LICENSES,ID,ETC Vendor: DARKNOOB Category: Other Worldwide > Worldwide Listing Feedback: New Hampshire FRESH FULLZ +PTIN+ATIN+EIN+CAR LICENSE PLATE+SSN Vendor: fraudmigo Category: Fraud Worldwide > Worldwide...
Drug Hub - US Adderall A80 IR 30mg x25 EXPRESS SHIP
http://drughu3yxkhhan5wng7szacie7tat5ppk6dmcdfykxs6ghlo4xqds7yd.onion/us_adderall_a80_ir_30mg_x25_express_ship.php
Log In Register Vendor Area Vendor Application Vendor Login Info Market PGP keys Market Links Canary Rules Features Bug Bounty Jabber Server Help Market Announcements Cart 0 unread messages Shopping Cart Info Cart is empty Close 0 XMR 1 XMR = USD 224.35 1 XMR = EUR 213.13 1 XMR = GBP 177.24 1 XMR = AUD 345.5 1 XMR = CAD 314.09 guest Log In Register Guest Settings Guest Settings Listing Default USD EUR GBP AUD CAD Default Currency 10 20 30 40 50 Items per page Close Save Show Categories Categories Drugs...
Overview and Logs for the Dev Meeting Held on 2016-09-11 | Monero - secure, private, untraceable
http://monerotoruzizulg5ttgat2emf4d6fbmiea25detrmmy7erypseyteyd.onion/2016/09/11/overview-and-logs-for-the-dev-meeting-held-on-2016-09-11.html
Soon™. Need to merge RingCT stuff into my zmq branch, then make the new RingCT-related RPC calls (as well as updating any others as needed), then should be golden for basic implementation. <tewinget> will try to get most of that done today or tomorrow.
For Privacy, Free Speech, and a Brighter Future | Electronic Frontier Foundation
http://supporters.iykpqm7jiradoeezzkhj7c4b33g4hbgfwelht2evxxeicbpjy44c7ead.onion/donate/summer--MM
Wallis and Futuna Western Sahara Yemen Zambia Zimbabwe Åland Islands State - select a state - Alabama Alaska American Samoa Arizona Arkansas Armed Forces Americas Armed Forces Europe Armed Forces Pacific California Colorado Connecticut Delaware District of Columbia Florida Georgia Guam Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Jersey...
New Address Blog
http://funkxxkovrk7ctnggbjnthdajav4ggex53k6m2x3esjwlxrkb3qiztid.onion
New Address Blog Add anti-capture against spy funksec53xh7j5t6ysgwnaidj5vkh3aqajanplix533kwxdz3qrwugid.onion funksecsekgasgjqlzzkmcnutrrrafavpszijoilbd6z3dkbzvqu43id.onion funksecsekgasgjqlzzkmcnutrrrafavpszijoilbd6z3dkbzvqu43id.onion
Start New Conversation
http://onioneqijkmjzozlnlg47scbs6qdj4zyo3nm5gsiyzac4s4j5sq2o6id.onion/submit_post.php
Start New Conversation DARAZON MARKET The Place of SOFTWARES, TOOLS, SERVICES Title: Details: Password (to delete post later): This password is only used to delete your post.
cantino/mcfly - GotHub
http://gothub.r4focoma7gu2zdwwcjjad47ysxt634lg73sxmdbkdozanwqslho5ohyd.onion/cantino/mcfly
For more details, please refer to the chrono-systemd-time documentation . Regex Dump supports filtering commands with regex. The regex syntax follows crate regex . For example: mcfly dump -r ' ^cargo run ' will dump all command prefixes with cargo run .
FRESH - New Order
http://z2pd2hepfa4bacdhmlovqud7khmiumoulxyrkdfr25pot5s5fw4gbuyd.onion/order_15.htm
FRESH Main Menu Support Order Reviews Faq New Order Order Details Type: PayPal Price: $1,010.00 Transfer: $16,250.00 Profit: $15,240.00 Status: Avalible Cancel Order Finalize Order Confirm policies By ordering you agree to the following Never share the PayPal ID from which you received the money.
Old New Money
http://kms6t2mz3hy5zenvuhitl4fzwsqltr4nqco3jah2nawqblyhb5r5fzid.onion
PRE-SHRED COUNTERFEIT You can buy pre-shred and counterfeit bills from us in the following currencies: USD ($$$) , GBP (£££) , EUR (€€€) To contact us send us an email - OldNewMoney@firemailhvtkqqwv33lzxs2tkhcqtjpcjayzwq4sjyva3pts3sr2vtqd.onion © 2013 - 2025 | OLD NEW MONEY 💵💶💷