About 15,080 results found. (Query 0.08600 seconds)
Scam List of Tor
http://sg7zvalmy5ykibandqleo5fcrrufcibi3xbs2t64yciwi5zolxb2cbyd.onion/list
TOR SCAM LIST VERIFIED SITES Report false listing Add new scam SCAM LINKS LIST Home The scam links list Here is the list of all the scam I and you know about. This list is not complete, but we can constantly update it together.
4 similar results skipped
Accounts - A1 dark
http://zw5tnvahmozqffqdyl5xpoayfhft4mjhikclddp7jvxbcfsixzjpvxyd.onion/index.php?category=1
A1 dark Accounts + Apple Developer Account Accounts Apple Developer Account $250 – $1,000 © 2025 A1 dark. All Rights Reserved.
30 x 200 Best quality Euro bills
http://deepmehruhlkmelzffkpcxathectjtnanzkgk7xw7ibuj6qieubpecqd.onion/30x200-eurocash-bills?page=4
Login/Register Catalog Support Messages Escrow Categories Carding Money Transfers Gift Cards Money Counterfeits Hacking Documents Electronics Login/Register Escrow Catalog Support Carding Money Transfers Gift Cards Money Counterfeits Hacking Documents Electronics 30 x 200 Best quality Euro bills 30 x 200 Best quality Euro bills Contact Vendor Enable JavaScript for contact vendor 30 x 200 Best quality Euro bills Vendor: Euro Cash Products Solds: 12111 Notice : Array to string conversion in...
About Us - Hire A Ethical Hacker | Cyber Investigator | Professional Ethical Hacker For Hire
http://q7bwarqf57y4ntxqt2besrvonbwaneg56but64xpcmywzmkqi5cjclyd.onion/about-us/index.html
Brilliant Hackers We are a group of best professional hacker from the dark web. We served on dark web from a long time but now after so many request from the peoples we have urge to solve the daily life problem of the peoples. our mission You can find thousands of peoples getting scammed by fake hackers for hire services these days.
h4ck3r - Hacking Services - Hire a Hacker
http://v7tgyh5ezhzjipsx6gtofdoywepzu4pvdypqwudgmvaegifc7jnqmeqd.onion
Technical Skills Web (HTML, CSS, Javascript, PHP, MySQL, MariaDB, Apache, NGINX). C/C++, Python. Social Engineering. Information Gathering. Hacking Web Technologies.
Dark Room
http://ictt75vgtko3i5pox4glnzfw4fxxlgtfxau7gjqolc4nfv6jtjfizayd.onion?thread=689762bfddd49
Dark Room Chat in real time with strangers. Messages are automatically updated every 15 seconds. Send
The incredible speed of memchr
http://glfwtfwhlsm2u5pw3b7crist7bt7fwepj2wgv3n3b64unj22v5435tyd.onion/blog/2022/12/10/The-Incredible-speed-of-memchr.html
These file formats are heavily text-based formats, e.g: fasta, .fastq, .sam, .vcf. A very typical operation we apply is finding a new line in a huge buffer. Think of something like: char* str = "ACGTACGTACGTACGTACGTACGT\nACGTACGTACGTACGTACGT\n" // find the position of the next new line So what is the fastest way of finding these new lines?
Border Cyber Group | Cybersecurity, Penetration Testing, Hack the Planet
http://nep55mmkm4qxunl4t6ixma6naxnmi2p74lwgdmw2kjvm4pdqdd4j2lid.onion/VectorNews.html
hack,hacker,hacker news,cybersecurity, penetration testing, hackerspace, cyberwar, cybercrime Site Map Home About Us Topics in AI Research Tools News HackThePlanet Dark Web Cyber Defense Reference Sources Multimedia Technical Blog Contact Us This Week in Tech News Hacked by Toothbrush - Hilarious! Oops: DanaBot Malware Devs Infected Their Own PCs U.S.
VIP72 - Buy Mobile Proxy - VIP2VPN by VIP72 - vip72.com
http://vip2vpnx57bzokdslmyd4v24gba4kf5upn4k7xg6tk7vyh7cpcmofyyd.onion/buy/mobile-proxy?c=iraq
Automatic and anonymous payment using Bitcoin or Litecoin. 1 Week 19 USD Targeting Country and ASN Automatic rotation IP Change IP on request, time Unlimited traffic Unlimited device Buy now 2 Weeks 29 USD Targeting Country and ASN Automatic rotation IP Change IP on request, time Unlimited traffic Unlimited device Buy now 1 Month 39 USD Targeting Country and ASN Automatic rotation IP Change IP on request, time Unlimited traffic Unlimited device Buy now 3 Month 99 USD Targeting Country and ASN Automatic...
liens - tor | titou onion
http://mgujzgtqcnn3majscmqpgwbzulgf3iuilmcx6qvkzfr5x5vx4iqolzad.onion/tor/links.html
liste de sites onion il est possible de contacter le support pour proposer des liens e-mails proton mail systemli mail mail2tor ( squirrel mail ) morke onion mail piss mail private MX mailum alt address underworld temp mail partage textes proton drive systemli paste ( private bin ) systemli pad ( ether pads ) tor paste write as private bin ( private bin ) BBW paste ( private bin ) antopie ( private bin ) systemli ( private bin ) zero bin ( private bin ) pasta micro bin dark bin sigsum (...
Text web browsers
http://r53zi7kxyqd72fuvhztzi25fo2bze7fqjefze7k6t6kiq74pzaq5suyd.onion/posts/2023/2023-12-04.html
getimiskon's space Home Back Text web browsers Posted in 2023-12-04 These days I have been messing with text based web browsers. At first it was just curiosity and something to mess with while I have to listen to the theoretical stuff in class (I've recently started attending classes in a trade school).
CVV FULLZ DUMPS - search
http://trustptbuy4oiyb2ydwljlucz5yfm7mh5x57sjfub2i5fxx3pr5g7kqd.onion/cat/search/page/1
Reviews Minimum reviews $ Maximum reviews $ Rating and up and up and up and up           Karen Personal information ppux65b6us3tk7b4...hxlwduad.onion Added: 10/14/24 5  (1) Verified This site has been verified by Trustpilot team PES Master LibreX raeqjne2mk7fac33...tvbbzkqd.onion Added: 10/03/24 0 Verified This site has been verified by Trustpilot team PES Master Dark Engine: anonymity and privacy darkent74yfc3qe7...rjlirvid.onion Added: 07/15/24 0 Verified This site has been verified by...